Х а б а р л а р ы известия



жүктеу 5.08 Kb.
Pdf просмотр
бет25/27
Дата22.04.2017
өлшемі5.08 Kb.
1   ...   19   20   21   22   23   24   25   26   27

 
                                                                               Серия биологическая и медицинская. № 3. 2015 
 
 
147 
ƏДЕБИЕТ 
 
[1]  Стакан  Г.А.,  Соскина  А.А.  Наследуемость  хозяйственно-полезных  признаков  у  тонкорунных  овец. – Новоси-
бирск, 1965. – С. 151. 
[2]  Петров А.И., Метлицкий А.В., Берус В.К. Влияние методов подбора на развитие некоторых признаков у австра-
ло-южноказахских помесей // Информ. листок КазНИИНТИ. – Алма-Ата, 1976. – № 520. – С. 5. 
[3]  Подгорная Т.М. Резервы повышения мясной и шерстной продуктивности овец кавказской породы // Повышение 
шерстной и мясной продуктивности тонкорунных и полутонкорунных овец. – М., 1986. – С. 79-82. 
[4]  Есқара  М.А.,  Абдраманов  К.,  Аккулов  Г.  Перспективность  генетического  совершенствования  продуктивных 
качеств  овец  парода  южно-казахский  меринос  на  юге  Казахстана // Матер.  межд.  науч-прак.  конф.,  посв. 100-летию                  
К. Мынбаеву. – Алматы: Бастау, 2006. – С. 114-121. 
[5]  Əбішов Б., Кенжебаев Т.Е., Жомартов А.М., Қонаева С. Қазақтың арқармериносы қойларының жүн өнімділігі // 
Жаршы. – Алматы: Бастау, 2003. – №11. – Б. 13-16.  
 
REFERENCES 
 
[1]  Stakan G.A., Soskina A.A. The heritability of economically useful traits in fine-wool sheep. - NEWS-birsk, 1965. - p. 
151. (in Russ.). 
[2]  Petrov A.I., Metlitski A.V., Berus V.K. The impact on the development of methods for the selection of certain traits in 
the Austro-lo-South Kazakh hybrids. Inform. KazNIINTI sheet. - Almaty, 1976. - № 520. - p. 5. (in Russ.). 
[3]  Podgornaya T.M. Reserves of meat and wool productivity of sheep Caucasian breed wool. Improving and fine-wool and 
meat productivity of semi sheep. - M., 1986. - P. 79-82. (in Russ.). 
[4]  Yeskara M.A., Abdramanov K., Akkulov G. The prospects of genetic improvement of the productive qualities of sheep 
Paroda South-Kazakh merinos in southern Kazakhstan. Proc. Int. Scientific-prac. Conf., dedicated. 100th anniversary of K. 
Mynbayev. - Almaty Bastau, 2006. - p. 114-121. (in Russ.). 
[5]  Abіshov B., Kenzhebaev T.E., Zhomartov A.M., Konaeva S. Қazaқtyң arқarmerinosy  қojlarynyң zhүn  өnіmdіlіgі. 
Zharshy. Almaty: Bastau, 2003. № 11. B. 13-16. (in Kaz.). 
 
 
ВЗАИМОСВЯЗЬ МЕЖДУ СЕЛЬСКОХОЗЯЙСТВЕННЫМИ И ПОЛЕЗНЫМИ ПРИЗНАКАМИ 
ЮЖНО-КАЗАХСТАНСКИХ МЕРИНОСНО-КУЮКСКИХ ВНУТРИПОРОДНЫХ ОВЕЦ 
 
А. Д. Дауылбай, М. М. Есқараев, А. Р. Абилдаева 
 
 
Южно-Казахстанский государственный университет им. М. Ауезова, Шымкент, Казахстан 
 
Ключевые  слова:  корреляция,  постэмбриональ,  скрешивания,  селекция,  сортировка,  мясо,  тонко-
рунный. 
В  сельскохозяйственной  промышленности,  особенно  в  овцеводстве  выращивании  и  разведении  овец 
важное  значение  придается  корреляционной  связи  селекционной  работе  в  разведении  ценных  пород  ме-
риносно-куюкских внутрипородных овец. В Южно-Казахстанской области в данное время ученые вплотную 
работают  над  этим  вопросом.  В  результате  этих  исследований  улучшается  ценность  породы,  особенно  это 
будет иметь значение в экономическом развитии хозяйств.  
В  связи  были  проведены  исследования по  изучению  овец  южказахстанских  мериносов,  их  живой  вес, 
взаимосвязь корреляционных показателей качества стриженной шерсти в хозяйствах. В результате пришли к 
выводу,  что  во  всех  исследуемых  группах  корреляционная  взаимосвязь  приплода  ягнят  имеет  хорошие 
показатели и высокое качество. 
 
Поступила 20.05.2015 г. 
 
 
 

Известия Национальной академии наук Республики Казахстан  
 
 
   
148  
N E W S 
OF THE NATIONAL ACADEMY OF SCIENCES OF THE REPUBLIC OF KAZAKHSTAN 
SERIES OF BIOLOGICAL AND MEDICAL 
 
ISSN 2224-5308 
Volume 3, Number 309 (2015), 148 – 153 
 
 
APHYLLOPHORALES FUNGI OF PROTECTED AREAS  
OF CENTRAL AND NORTH-EAST KAZAKHSTAN:  
STUDYING SPECIES AND TAXONOMY, MOLECULAR  
AND GENETIC IDENTIFICATION, CREATION COLLECTIONS  
OF VALUABLE STRAINS  
 
S. A. Abyev, R. Z. Asylhanova, G. B. Alyeva, A. Tagabaeva 
 
Eurasian national university named after L. N. Gumilev, Astana, Kazakhstan  
 
Keywords: aphyllophorales fungus, collection of strains, macromycetes, mycelial culture, PCR diagnostics. 
Abstract. In four national natural park located in the Central and North East parts of Kazakhstan there were 
identified 19 species of aphyllophorales fungi. Identified species are given taxonomic, systematic, ecological and 
trophic, culturally- morphological characteristics. By sequencing and analysis of ITS DNA sequences constructed 
phylogenetic tree of relations. The sequences were identified by comparison with the respective types of ITS 
sequences deposited in the international database of the Gene Bank. 
On the territory of the four national parks located in the Central and North-East Kazakhstan there were revealed 
several species of aphyllophorales fungi. Research on solid agar medium features radial mycelial growth and 
character formation of colonies in 57 strains of the most valuable in respect of 17 species of edible sapro- xylotrophs 
and showed the following results. All the strains we investigated were in the rate of slow- and middle growing 
mycelial colonies. The vast majority of strains (48 strains) had high growth rate at 7-10 days of cultivation, and the 
remaining strains (9 strains) had the highest growth rate at 17-18 days from the beginning of cultivation. The most 
dense mycelium becomes over 4-4.5 weeks after the start of cultivation. Pigmentation of colonies is observed on the 
33-42 day, mycelial film is formed 39-62 days of cultivation. 
 
 
УДК 581.5.(235.216) 
 
ОРТАЛЫҚ ЖƏНЕ СОЛТҮСТІК-ШЫҒЫС ҚАЗАҚСТАННЫҢ  
АЙРЫҚ- ША ҚОРҒАЛАТЫН ТАБИҒИ АЙМАҚТАРЫНЫҢ 
АФИЛЛОФОРА САҢЫРАУҚҰЛАҚТАРЫ: ТҮРЛІК  
ЖƏНЕ ТАКСОНДЫҚ ҚҰРАМЫ, БАҒАЛЫ ТҮРЛЕРІНЕН  
ШТАМДАР КОЛЛЕКЦИЯСЫН ЖАСАУ ЖƏНЕ 
МОЛЕКУЛАЛЫҚ-ГЕНДІК ВЕРИФИКАЦИЯЛАУ 
 
С. А. Абиев, Р. З. Асилханова, Г. Б. Алиева, А. Тағабаева 
 
Л. Н. Гумилев атындағы Еуразия ұлттық университеті, Астана, Қазақстан 
 
Тірек  сөздер:  афиллофора  саңырауқұлақтары,  штаммдық  коллекция,  макромицеттер,  мицелиальды 
культура, ПТР диагностикасы. 
Аннотация. Қазақстанның орталық жəне солтүстік-шығыс аймақтарында орналасқан төрт мемлекеттік 
ұлттық  табиғи  парктердің  территориясынан  афиллофора  саңырауқұлақтарының 19 түрі  анықталды.  Анық-
талған  түрлерге  таксондық,  жүйелік,  экологиялық-трофикалық  талдаулар  жасалды.  Қатты  агарлы  қоректік 
орталарға  бөлініп  алынған  штамдарға  культуралық-морфологиялық.  сипаттамалар  берілді.  Секвендеу  жəне 

ISSN 2224-5308
 
                                                                               Серия биологическая и медицинская. № 3. 2015 
 
 
149 
ДНҚ  тізбегінің ITS реттігін  талдау  нəтижесінде  кейбір  түрлердің  идентификациялық  дəлдігі  верификация-
ланды, филогенетикалық туыстық шежіресі жасалып, ол халықаралық Gene Bank қорында сақтаудағы сəйкес 
түрлердің ITS реттігімен салыстырылды.  
 
Афиллофора  саңырауқұлақтары  түрлерінің  саны  жағынан  гименомицеттердің  ішінде 
агарикалардан  соң  екінші  орындағы  қатар [1]. Алуан  түрлі  экологиялық  жəне  трофикалық  топ-
тардан  тұрады.  Сапротрофтары  ормандағы  құлаған  ағаштарды,  өлі  жапырақ-бұтақ  төсемігін 
шірітіп,  ыдратып  топырақты  өсімдіктің  өсуіне  қажет  гумуспен  жəне  қоректік  минералдық 
элементтермен байытады.  
Паразиттік  түрлері  тірі  ағаш  діңінде,  бұтақтарында  тіршілік  етіп  орман  шаруашылығына, 
көшеттік  питомниктерге,  қаладағы  жасыл  желекке,  жол  бойларындағы,  егіс  алқаптарындағы 
желден  қорғау,  қар  тоқтату  мақсатында  отырғызылған  жолақ  ормандарға,  жеміс  бауларына, 
ботаникалық бақтар мен дендрарийлерге үлкен зиян келтіреді. Сондай-ақ құрылысқа жəне басқа да 
əртүрлі  қажеттілік  үшін  дайындалған  өңделген  ағаштарды,  ғимараттардың,  тұрғын  үйлердің, 
кемелердің,  жол  құрылысының  (шпал,  көпір)  ағаштан  жасалған  бөліктерін  шірітіп  адамға  үлкен 
зиян  əкелетін  түрлері  де  бар.  Бірқатар  түрлерін  (Polyporus varius, Polyporus squamosus, Fomes 
fomentarius ) жас кезінде адам ерте заманнан бері тағамға, басқа түрлерін емдік мақсатта (Inonotus 
obliquus,  Coriolus versicolor, Fomes fomentarius, Ganoderma applanatum, Piptoporus betulinus, т.б.) 
пайдаланып келеді.  
Соңғы кездері трутовиктердің бірқатар тірлері əртүрлі биологиялық белсенді заттарды өндіру 
үшін,  əсіресе  фармакология  саласында,  қолданыс  табуда.  Мəселен,  Coriolus versicolor, Grifola 
frondosa, Schizophyllum commune  сияқты  түрлер  макромицеттерден  емдік-профилактикалық 
препараттар алу өндірісінде əлемдік бестік түрдің ішіне кіреді. Осы түрлердің жəне бірқатар басқа 
афиллофоралардың  негізінде  қазіргі  кездері  қатерлі  ісікке,  қабынуға  қарсы,  антибактериялық, 
антивирустық, жəне гепатопротекторлық препараттар дайындалады [1]. 
Қазақстанда  афиллофора  саңырауқұлақтарына  арналған  арнайы  жұмыстардың  саны  небары 
екеу  ғана: «Қазақстанның  споралы  өсімдіктер  флорасының» 4-ші  томы [2] жəне  Ж.  А.  Адамжа-
нованың  «Іле Алатауының афиллофора саңырауқұлақтары» атты кандидаттық диссертациясы [3]. 
«Флорадағы»  мəліметтер,  өткен  ғасырдың 40-50-ші  жылдары  жүргізілген  зерттеулер  мен  сол 
уақытқа  дейінгі  жиналған  материалдар  негізінде  берілген.  Ал  екінші  жұмыста  Республика 
көлемімен  салыстырғанда  шағын  ғана  аудан – Іле  Алатуы  (Солтүстік  Тянь-Шань)  қамтылған. 
Кейіннен жарық көрген, сəл де болса біздің тақырыпқа қатысы бар бірен-саран басылымдар [4-8] 
жалпы  микофлоралық  зерттеулердің,  немесе  ботаникалық  экспедициялар  барысындағы  жол-
жөнекей жиналған үлгілерді талдау нəтижелері болып табылады.  
Зерттеу  жұмыстары  Қазақстанның  Орталық  жəне  Солтүстік-Шығысында  орналасқан  төрт 
мемлекеттік  ұлттық  табиғи  парктер  (МҰТП)  территорияларында  жүргізілді.  Бұлардың  екеуі 
Ақмола облысында («Бурабай», «Көкшетау»), бір-бірден Қарағанды («Қарқаралы») жəне Павлодар 
(«Баянауыл»)  облыстарында.  Бұл  өлкені  таңдау  себебіміз  осы  ауқымды  аймақтың  афиллофора 
саңырауқұлақтарының  өте  аз,  немесе  мүлде  зерттелмегендігіне  байланысты.  Тақырыпқа  қатысты 
ертеректе  жарияланған  бірен-саран  мақалалар  мен  ҚР  БҒМ  Ботаника  жəне  фитоинтродукфия 
институтының  «Гербарий  қорында»  сақталған  аздаған  гербарийлік  материалдар  өткен  ғасырдың 
30-60  жылдары  жиналғына  үлгілерге  негізделген.  Арада  өткен 50-70 жыл  көлемінде,  негізінен, 
зиянды антропогендік факторлардың əсерінен, Қазақстанның басым көпшілік аймақтарында, оның 
ішінде  біздер  зерттеген  аймақтың  топырақ-өсімдік  жамылғыларында,  айтарлықтай  өзгерістер 
белең алды.  
МҰТП  территорияларын  таңдауымыздың  екінші,  əрі  басты  себебі,  мемлекет  тарабынан 
айрықша  қорғалатын  табиғи  аймақтар  адами  əсерлерге  азырақ  ұшырайды,  ал  ұлттық  парктердің 
қорықтық  зоналарда  мұндай  əсерлер  мүлде  тоқтатылады.  Мұндай  жерлерде  тіршілік  үдерістері 
барынша  табиғи  күйде  сақталады,  қоршаған  көрші  аудандарға  қарағанда  биоалуантүрлілікке  бай 
келеді,  оның  ішінде  саңырауқұлақтардың  да  алуан  түрлі  қауымдастықтарының  өсіп-дамуына 
қолайлы жағдайлар қалыптасады.  
Соңғы  жылдары  морфологиялық  белгілері  негізінде  анықталған  түрлерді  верификациялауға 
мүмкіндік  беретін ITS1 жəне ITS2 жəне  басқа  да  маркерлерді  пайдалананатын  молекулалық-

Известия Национальной академии наук Республики Казахстан  
 
 
   
150  
генетикалық  əдістер  саңырауқұлақ  түрлерін  идентификациялауда,  таксондық  топтарға  жіктеуде 
жəне жүйелеуде, филогенетикалық шежірелерін жасауда үлкен қолданысқа ие болып отыр [9, 10]. 
Ұсынылып  отырған  осы  жұмыста  біздер  де  афиллофора  саңырауқұлақтарының  кейбір  түрлерін 
верификациялау мақсатында ITS1 жəне ITS2 маркерлерін қолдандық.  
 
Зерттеу нысандары мен əдістері 
 
Афиллофора саңырауқұлақтарының зерттеу аймағында таралуын, паразиттік жəне микориздік 
түрлерінің иелік өсімдіктерін, сапротрофтық түрлерінің субстраттарын анықтау, жемісті денелерін 
жинау арнайы жоспарланған маршруттық экспедициялық зерттеулер барысында жүзеге асырылды. 
Жемістік денелердің үлгілері жиналған географиялық координаттар JPS арқылы анықталды. Саңы-
рауқұлақ  түрлерін  идентификациялау  олардың  жемісті  денелерінің  сыртқы  морфологиялық 
белгілеріне,  гименофор  типіне,  базидиялыры  мен  базидиоспораларының  сипаттамаларына  жəне 
жасанды  қоректік  орталардағы  культуралық  ерекшкліктеріне  негізделіп  жасалды.  Саңырауқұ-
лақтың  микроқұрылымдарын  зерттеу  «Микмед-1»  микроскопын  қолдану  арқылы,  ал  олардың 
микрофотосуреттері  микроскопқа  кіріктірілген  арнайы  құрылғылар (Exilim-S880, SAMSUNG-
ES65, Canon-PC1474) көмегімен  компьютер  экранына  шығарылып,  суретке  түсірілді.  Жемісті 
денелердің  макросуреттері «Canon» цифрлік  фотоаппараты  арқылы  түсірілді [2, 11, 12]. Жемісті 
денелердің макросуреттері «Canon» цифрлік фотоаппараты арқылы түсірілді. 
Саңырауқұлақтың  жемісті  денесінен  таза  культураларды  бөліп  алу  екі  түрлі  əдіспен 
жүргізілді:  ұлпалық  жəне  споралық.  Ұлпалық  культураны  бөліп  алу  үшін  саңырауқұлақтың  əлі 
жас,  сүректелмеген  жемісті  денесінен  көлемдері 0,5-0,8 см  шамасында  куб  пішіндес  кесінділер 
скальпельмен  тілініп  алынып,  алдын-ала  Петри  табақшаларына  құйылып  қатырылған  агарлы 
қоректік  орталарға  отырғызылды.  Осылай  инокуляцияланған  Петри  табақшалары  термостатта 
(26°С) орналастырылды.  
Бөлініп алынған таза культураларды өсіру мақсатында əртүрлі қатты агарлы қоректік орталар 
(«Чапек–Докс», «Мурасиге-Скуг», Картопты-глюкозалы агар») пайдаланылды. Таза культураларды 
бөліп алу, қайта себу, көбейту жұмыстары ламинарлық бокста жүргеділді. 
Споралық  культураларды  алу  үшін  ішінде  агарлы  қатты  қоректік  орта  құйылып  қатырылған 
ашық Петри табақшасының үстіне саңырауқұлақтың жемісті денесін гименофорын төмен қаратып, 
споралары  табақшаға  түсетіндей  етіп  тұғырға  бекіттік.  Мұның  алдында  гименофор  беті 
шаң-топырақтан  жəне  басқа да  жабысқан  заттардан тазартылып, 96°С  спиртпен  сүртілді. Осылай 
Петри  табақшасын  бетіндегі  жемісті  денесімен  ішкі  камерасы  зарасыздандырылған  термостатта 
22°С-та  бір  тəулік  бойы  ұстадық.  Сонан  соң  қоректік  ортасы  инокуляцияланған  Петри  табақша-
сының  қақпағын  жауып  қайтадан  термостатқа 26°С-қа  инкубациялауға  қойдық.  Таза  культура 
арасында кездейсоқ пайда болатын əртүрлі микроорганизмдерден арылу үшін культураны «қайта 
себу»  əдісін  қолдандық.  Сондай-ақ  осы  мақсатта  қоректік  ортаға  спецификалық  антибиотиктерді 
(ампициллин - 100-200 мг/бірлік;  фундазол - 1:100 – 2:100) қосудың  да  оң  нəтиже  беретінін 
ескерген жөн.  
Қоректік  орталардағы  мицелийлік  колониялардың  өсу  ерекшеліктерін,  қарқынын  бағалау 
бүкіл бақылау мерзімі бойы əрбір екі күн сайын жүргізілді. Келесідей көрсеткіштер есепке алынды: 
колонияның  текстурасы  жəне  формасы,  мицелийдің  тығыздығы,  қалыңдығы  жəне  пигментация-
лануы,  колонияның  радиальдық  өсімінің  орташа  тəуліктік  жылдамдығы,  өсу  коэффициенті, 
мицелийлік тоғалардың жəне пленканың пайда болуы.  
Кейбір  анықталған  түрлердің  идентификациялық  дəлдігін  верификациялау  мақсатында 
молекулалық идентификациялау, яғни секвендеу жəне ДНҚ тізбегінің ITS реттігін талдау əдісі қол-
данылды.  Нəтижесінде  түрлердің  филогенетикалық  туыстық  шежіресі  жасалып,  ол  халықаралық 
Gene Bank қорында  сақтаудағы  сəйкес  түрлердің ITS реттігімен  салыстырылды.  Түрлердің 
филогенетикалық туыстық шежіресін жасау үшін Mega 5 компьютерлік бағдарлама пакетінің [13] 
нысанының  табиғи болмысына  барынша  жақындату əдісі  қолданылды. Есептеу  секвенделген ITS 
тізбегінің 705 сайттары бойынша жүргізілді. Нуклеотидтік реттік талданып ол SeqMan (DNA Star) 
бағдарламасындағы  осындай  жалпы  реттікпен  біріктірілді.  Сонан  соң  одан  ұштық  фрагменттері 
(көрсеткіштері  төмен,  маңызсыз)  кесіліп  тасталды.  Осылайша  алынған  нуклеотидтік  тізбек Gene 
Bank-тегі BLAST альгоритмі бойынша идентификацияланды. 

ISSN 2224-5308
 
                                                                               Серия биологическая и медицинская. № 3. 2015 
 
 
151 
Нəтижелер жəне оларды талдау 
 
Зерттелген  аймақта  біз  анықтаған  афиллофора  саңырауқұлақтарының  жалпы  саны 19 түр. 
Жүйелік  жəне  таксондық  тұрғыда  олар 14 туысқа  жəне 8 тұқымдасқа  кіреді.  Осы  барлық 
анықталған түрлердің 7 туысқа жататын 9 түрі Polyporaceae тұқымдасынан. Оның ішінде Polyporus 
туысының 3 түрі  (P. arcularius, P. squamosus, P. varius),  Coriolus  туысының 2 түрі  (С.  versicolor,                
C. zonatus),  қалған  үш  туыстың  бір-бірден  түрлері  (Dаеdaleopsis  confragosa, Cerrena unicolor, 
Hirschioporus pergamentus) бар. 
Басқа түрлердің таксондық жағдайлары төмендегідей. Екі туысқа жататын үш түр (Fomitopsis 
pinicola, F. rosea, Piptoporus betulinus) Fomitopsidaceae тұқымдасының өкілдері, бір-бір түрден екі 
туыс (Irpex lacteus, Phlebia tremellosa) Meruliaceae тұқымдасына жатады. Қалған бес түр жеке-жеке 
келесідей 5 тұқымдасқа жатады: Thelephora terrestris (Thelephoraceae), Sarcadon fuligineo-violaceus 
(Bankeraceae), Ramaria formosa (Comphaceae),  Osmoporus odoratus  (Gleophyllaceae), Ganoderma 
applanatum (Ganoderma taceae). 
Анықталған  түрлердің  басым  көпшілігі  өлі  ағаш  діңінде  (құлап  жатқан,  əлі  құламағын), 
əртүрлі  себептермен  сынған,  немесе  кесіп  ағаннан  кейін  қалған  ағаш  түбіртегінде  (томарында), 
бірен-саран  түрі (Sarcadon fuligineo-violaceus, Ramaria formosa) төсемікте,  гумуста тіршілік  ететін 
сапротрофтар. Аздаған түрлері тірі, немесе қартайған жəне қолайсыз орта жағдайына байланысты 
əлсіреген  ағаштарда,  бұталарда  тіршілік  ететін  паразиттер  (Fomitopsis penicola, Piptoporus 
betulinus),  немесе  жартылай  паразиттер  (Polyporus squamosus, Ganoderma applanatum).  Бірқатар 
түрлер (Dаеdaleopsis confragosa, Cerrena unicolor, Fomitopsis pinicola, Ganoderma applanatum, 
Piptoporus betulinus жəне  басқалар)  əртүрлі  ББЗ  (биологиялық  белсенді  заттар)  продуценттері 
ретінде  жəне  жəне  фармокологиялық  мақсатта  қызығушылық  тудырады. 2 түр  (Polyporus varius, 
Polyporus squamosus)  балауса  кезеңінде  жеуге  жарамды  жəне 1 түр  (Ramaria formosa)  улы  саңы-
рауқұлақтар  қатарына  жатады.  Қарастырылып  отырған  саңырауқұлақтардың  тіршілігі  негізінде 
жалпақ  жапырақты  ағаш-бұталармен,  кейбір  түрлері  қылқан  жапырақтылармен,  кейде  өсімдіктің 
осы екі тобымен де байланысты.  
Өткен ғасырдың 90-шы жылдарынан бастап саңырауқұлақтарды жүйелеуде молекулалық тəсіл 
жетекші  орынға  ие  болды.  Бұл  тəсіл  семангидтерді  (ақуыз,  РНҚ,  ДНҚ)  талдауға  негізделген. 
Молекулалық жүйелеу, немесе гендік (нəсілдік) жүйелеу (геносистематика), жеке гендердегі, неме-
се ДНҚ-ның кейбір бөліктеріндегі нуклеотидтердің орналасу ретін анықтауға жəне кладистикалық 
тəсілмен  филогенетикалық  тармақтарды  құрастыруға,  таксондардың  кез  келген  деңгейіндегі 
филогенетикалық  байланыстарын  анықтауға  жəне  олардың  моно-,  немесе  полифильдік  жолмен 
пайда болғанын болжауға мүмкіндік береді [14]. 
Классикалық  (морфологиялық-культуралық)  тəсілмен  анықталған  афиллофора  саңырауқұ-
лақтарының идентификациялық дəлдігін молекулалық-гендік əдіспен верификациялау үшін 4 түрлі 
саңырауқұлақтан  бір-бір  штаммнан  алынды: Fp8 (Fomitopsis pinicola), Pa5 (Polyporus arcularius), 
Irl2 (Irpex lacteus)  жəне Pht7 (Phlebia tremellosa).  Олардан  бөлініп  алынған  ДНҚ-ры  секвенделіп, 
ITS  тізбектері  талданған  сараптамалары GeneBank халықаралық  қорында  сақтаулы  сəйкес 
түрлердің ITS тізбектерімен салыстырылды. Нəтижесі 1-кестеде көрсетілген. 
 
1-кесте – Біздің штамдар (түрлер) мен GenBank қорындағы сəйкес түрлердің ITS тізбектерінің сəйкестігі 
 
Саңырауқұлақ түрі 
Штамм (біздікі) GenBank 
қорындағы түрдің № (код) ITS 
сəйкесті, % 
Fomitopsis pinicola 
Fp8 
KJ857263.1 
98 
Polyporus arcularius 
Pa5 
JQ283965.1 
99 
Irpex lacteus 
Irl2 
JX290578.1 
99 
Phlebia tremellosa 
Pht7 
GU062266.1 97 
 
1-кестеде  көрсетілгендей,  біздің  штамдар  мен Gene Bank қорындағы  сəйкес  түрлердің  ДНҚ 
ITS  тізбектерінің  салыстырмалы  ұқсастығы  төрт  түр  бойынша  да  өте  жоғары – 97-99%. Бұл  бір 
жағынан  морфологиялық  жəне  культуралық  ерекшеліктері  негізінде  анықталған  біздің  түрлердің 
идентификациялық дəлдігін көрсетсе, ал екінші жағынан – географиялық алшақтығына, оқшаулық-

Известия Национальной академии наук Республики Казахстан  
 
 
   
152  
тарына қарамастан біздің түрлер мен GeneBank қорында жинақталған сəйкес түрлер экотиптерінің 
өте жоғары дəрежеде генотиптік ұқсастығын дəлелдейді.  
Қатты  агарлы  қоректік  ортада  афиллофора  саңырауқұлақтарының 20 штамының  мицелилік 
колонияларының  культуралық-морфологиялық  өсіп-даму  ерекшеліктерін  зерттеу  келесідей  нəти-
желерді көрсетті (2-кесте).  
 
2-кесте – Штамдардың қоректік ортадағы мицелилік колонияларының өсу-даму сипаттамасы 
 
Штамдар 
Өсіру ұзақтығы, тəулік 
Өрмектəрізді 
мицелий 
Мицелидің 
тығыздалуы 
Мицелийде 
түйіндердің 
пайда болуы 
Мицелийдің 
пигменттенуі 
Мицелиилік 
пленканың пайда 
болуы 
Fp 8 (Fomitopsis pinicola) 
6-8 
15-16 
24-25 
31-33 
38-39 
Pa3 (Polyporus arcularius) 
7-8 
16-18 
23-26 
29-32 
39-41 
Irl2 (Irpex lacteus) 
6-8 
13-16 
23-25 
29-32 
38-40 
Pht7 (Phlebia tremellosa) 
7-8 
12-14 
23-24 
30-31 
35-37 
 
Қоректік  ортаға  отырғызылған  саңырауқұлақтың  жемістік  денесінің  ұлпалық  кесіндісінің 
айналасында 2-3 күннен  соң  ақ  үлпілдек  мицелий  зеңі  пайда  болды.  Өсудің  бастапқы  сатысында 
зең  өрмекші  торына  ұқсас,  сонан  соң  ол  ақ  ұнтақ  тəрізді,  кейінірек  тығыздалып,  киізге  ұқсап, 
субстрат  бетіне  жайыла  өседі.  Петри  табақшаларындағы (d=95мм)  қоректік  ортаның  мицелий 
колониясымен  толық  жабылуы  штамдардың  басым  көпшілігінде (17 штамм),  орташа  алғанда, 
24-26 күннен соң байқалды.  
А.  С.  Бухалоның [15] классификациясына  сəйкес  базидиалық  саңырауқұлақтарды  мицелилік 
колонияларының  өсу  жылдамдығына  қарай  үш  топқа  бөлінеді: I – тез  өсетін  (ӨК > 100), II – 
орташа қарқынмен өсетін (ӨК = 50-100) жəне III – баяу өсетін (ӨК < 50). (ӨК - өсу коэффициенті). 
Біздер зерттеген штамдардың басым көпшілігі (17 штамм) орташа өсетін топқа жатады. Бұлардың 
мицелилік колонияларының ең қарқынды радиалдық өсуі культураның 5-9-шы тəуліктеріне сəйкес 
келді. 
2-кестеде  молекулалық  идентификациялауға  пайдаланылған (1-ші  кестеге  қара)  штамдардың 
өсу сипаттамалары көрсетілген. 
2-кестеде  көрсетілгендей,  қоректік  ортада  өсу-даму  барысында  саңырауқұлақтардың  əртүрлі 
штамдарының  арасында  мицелилік  колонияларының  морфологиялық  өзгерістерінің  келесі  реттік 
фазаларына  өту  мерзімдерінде  айтарлықтай  айырмашылықтар  жоқ.  Əртүрлі  агарлық  орталарда, 
26,5
о
С-қа тең тұрақты температурада, мицелилік культуралар сипаты, шамамен бір аптадан кейін, 
өрмекші торы тəріздес болады. Мицелийдің тығыздалуы 2 (Pht7) – 2,5-3(Pa3) апта өте басталады. 
Мицелийдегі  тығыз  түйіндердің  (бляшкалар)  пайда  болуы 23-26 тəуліктер  аралығында  байқалды. 
Мицелийдің пигменттенуі – 29-33 тəулікте, ал мицелийлік пленканың пайда болуы жəне колония 
түсінің солғын тартуы өсуірудің 35-37 (Pht7) - 39-41(Pa3) тəуліктеріндеде басталады.  
 
ƏДЕБИЕТ 
 
[1]  Жизнь растений. – Т. 2. – М., 1976. – 479 с. 
[2]  Шварцман С.Р. Флора споровых растений Казахстана. – Т. 4: Гетеробазидиальные и автобазидиальные грибы. – 
Алма-Ата, 1964. – 715 с. 
[3]  Адамжанова Ж.А. Афиллофоровые грибы Заилийского Алатау: Автореф. канд. дис. – Алматы, 2000. – 24 с. 
[4]  Валиева  Б.Г.,  Нам  Г.А.,  Адамжанова  Ж.А.  К  микофлоре  Ботанических  садов  в  Казахстане  проблемы 
дендрологии, цветоводства, плодоводства // Мат-лы конф. 6-10 октября 1997 г. – Крым. Ялта, 1997. – С. 134-140. 
[5]  Abiev S.A., G. A., Samgina D.I., Valieva B.G., Adamjanova J.A. Study of macromycetes in Almaty Botanical Garden // 
Plant life in South-West and Cental Asia V International Symposium 18-22 may 1998. – Tashkent, 1998. – Р. 37. 
[6]  Abiev S.A., Nam G., Adamjanova J. To Aphyllophorales fungi of Zaili Alatay // XVI International Bot. Congress, 
Abstracts, St-Lous, 1999. – Р. 178. 
[7]  Адамжанова Ж.А. К микофлоре афиллофоровых грибов Заилийского Алатау. – Алматы, 2000. – Деп. В Каз. Гос. 
ИНТИ. №1. – С. 18. 
[8]  Абиев С.А, Нам Г. А., Бызова З. М., Самгина Д. И., Васягина М.П., Адамжанова Ж. А., Микро-и макромицеты 
Маркакольского  заповедника // Труды  Междунар.  конф.,  посвящ. 100-летию  организации  исследований  по  микологии 
криптогамной ботанике. – СПб., 2000. – С. 47-48. 
[9]  Иванов  Д.М.  Анализ  областей ITS1-5,8S-ITS2 и IGS1 рДНК  видов  рода Leccinum // Сб.  мат-лов V Междунар. 
конф. «Изучение грибов в биогеоценозах». – Пермь, 2009. 

ISSN 2224-5308
 
                                                                               Серия биологическая и медицинская. № 3. 2015 
 
 
153 
[10]  Шнырева А.А., Шнырева А.В. Генотипирование культивируемых штаммов съедобного гриба вешенки Pleurotus 
// Мат-лы VI Всероссийского конгресса по медицинской микологии. – Т. XII. – М., 2014. – С. 272-273. 
[11]  Бондарцев А.С. Трутовые грибы Европейской части СССР и Кавказа. – Москва –Ленинград: Изд. Академии наук 
СССР, 1953. – 727 с. 
[12]  Ainsworth J., Bisby’s. Dictionary of the Fungi. – 8th ed. by D. L. Hawksworth, P.M. Kirk, B. C. Sutton, D. M. Pegler. – 
CAB International, Wallingford. U.K. – 1995. – 616 p.  
[13]  Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S. (2011). – MEGA5: Molecular Evolutionary 
Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. – Molecular Biology 
and Evolution. – 28: 2731-2739. 
[14]  Əбиев C.Ə. Саңырауқұлақтар патшалығын жүйелеудегі заманауи көзқарастар // ҚР ҰҒА Хабарлары. Биология 
жəне медицина сериясы. – 2011. – № 5 (287). – 3-18 б. 
[15]  Бухало А.С. Культивирование съедобных и лекарственных грибов. Практические рекомендации. – Киев, 2004. – 
128 c. 
 
REFERENCES 
 
[1]  Life of plants. - V. 2. - M., 1976. - 479 p.  
[2]  Schwartzman S.R. Flora spore plants in Kazakhstan. - V. 4: Heterobasidial and autobasidial fungi. - Almaty, 1964. - 715 p.  
[3]  Adamzhanova Zh.A. Aphyllophorales fungi of the Trans-Ili Alatau: Autoref. cand. dis. - Almaty, 2000. - 24 p.  
[4]  Valieva B.G., Nam G.A., Adamzhanova Zh.A. To mycoflora of Botanical gardens in Kazakhstan problems of 
dendrology, floriculture, fruit growing. Materials of conf. October 6-10, 1997 - Crimea. Yalta, 1997. - p. 134-140. 
[5]  Abiev S.A., G. A., Samgina D.I., Valieva B.G., Adamjanova J.A. Study of macromycetes in Almaty Botanical Garden // 
Plant life in South-West and Cental Asia V International Symposium 18-22 may 1998. – Tashkent, 1998. – Р. 37. 
[6]  Abiev S.A., Nam G., Adamjanova J. To Aphyllophorales fungi of Zaili Alatay // XVI International Bot. Congress, 
Abstracts, St-Lous, 1999. – Р. 178. 
[7]  Adamzhanova Zh.A. To mycoflora of aphyllophorales fungi of the Trans-Ili Alatau. - Almaty, 2000. - Dep. The Kaz. St. 
ISTI. №1. - p. 18. 
[8]  Abiyev S.A., Nam G.A., Byzova Z.M., Samgina D.I., Vasyagina M.P., Adamzhanova Zh.A. Micro and macromycetes of 
the Markakol reserve. Proceedings of the Intern. Conf., dedicated. to 100th anniversary of the organization of research in 
mycology cryptogamic botany. - SPb., 2000. - P. 47-48. 
[9]  Ivanov D.M. Analysis of the areas ITS1-5,8S-ITS2 rDNA and IGS1 species Leccinum. Coll. mat-catching V Intern. 
Conf. "The study of fungi in ecosystems." - Perm, 2009. 
[10]  Shnyreva A.A., Shnyreva A.V. Genotyping of strains cultivated edible oyster mushroom Pleurotus. Materials of VI All-
Russian Congress of Medical Mycology. - V. XII. - M., 2014. - p. 272-273. 
[11]  Bondartsev A.S. Polyporaceae of the European part of the USSR and the Caucasus. - Moscow -Leningrad Univ. 
Academy of Sciences of the USSR, 1953. - 727 p. 
[12]  Ainsworth J., Bisby’s. Dictionary of the Fungi. 8th ed. by D. L. Hawksworth, P.M. Kirk, B. C. Sutton, D. M. Pegler. 
CAB International, Wallingford. U.K. 1995. 616 p.  
[13]  Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S. (2011). MEGA5: Molecular Evolutionary Genetics 
Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and 
Evolution. 28: 2731-2739. 
[14]  Abiyev S.A. Modern approaches to the kingdom of fungi. News of NAS. A series of biology and medicine. - 2011 - No. 
5 (287). - 3-18 p. 
[15]  Bukhalo A.S. Cultivation of edible and medicinal mushrooms. Practical recommendations. - Kyiv, 2004. - 128 p. 
 
АФИЛЛОФОРОВЫЕ ГРИБЫ ОСОБО ОХРАНЯЕМЫХ ПРИРОДНЫХ ТЕРРИТОРИЙ 
ЦЕНТРАЛЬНОГО И СЕВЕРО-ВОСТОЧНОГО КАЗАХСТАНА:  
ВИДОВОЙ И ТАКСОНОМИЧЕСКИЙ СОСТАВ, СОЗДАНИЕ КОЛЛЕКЦИИ ШТАММОВ  
ЦЕННЫХ ВИДОВ И ИХ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКАЯ ИДЕНТИФИКАЦИЯ 
 
С. А. Абиев, Р. З. Асилханова, Г. Б. Алиева, А. Тагабаева 
 
Евразийский национальный университет им. Л. Н. Гумилева, Астана, Казахстан 
 
Ключевые слова: афиллофоровые грибы, коллекция штаммов, макромицеты, мицелиальная культура, 
ПЦР диагностика.  
Аннотация.  На  территории  четырех  Государственных  национальных  природных  парков,  располо-
женных  в  Центральном  и  Северо-Восточном  Казахстане  идентифицировано 19 видов  афиллофоровых 
грибов.  Выявленным  видам  даны  таксономические,  систематические,  эколого-трофические  и  культураль-
но-морфологические  характеристики.  Методом  секвенирования  и  анализа ITS последовательности  ДНК 
построено филогенетическое дерево родства изученных видов. Полученные последовательности были иден-
тифицированы путем сопоставления с ITS последовательностям соответствующих видов, депонированных в 
международной базе данных Gene Bank.
 
 
Поступила 20.05.2015 г. 

Известия Национальной академии наук Республики Казахстан  
 
 
   
154  
N E W S 
OF THE NATIONAL ACADEMY OF SCIENCES OF THE REPUBLIC OF KAZAKHSTAN 
SERIES OF BIOLOGICAL AND MEDICAL 
 
ISSN 2224-5308 
Volume 3, Number 309 (2015), 154 – 161 
 
 
AGARICALES EDIBLE FUNGI OF PROTECTED AREAS  
OF CENTRAL AND NORTH-EASTERN KAZAKHSTAN: CREATION  
OF STRAINS COLLECTION AND MOLECULAR IDENTIFICATION  
 
S. A. Abiev
1
, A. V. Shnyreva
2
, G. A. Nam
3
,
 
R. Z. Asilkhanova
1
, G. Abisheva

 
1
Eurasian National University named after L. N. Gumilyov, Astana, 
2
Moscow State University named after M. V. Lomonosov, Moscow,  
3
RSE "Institute of Botany and phytointroduction" MES RK, Almaty, 
4
RSE "National Center for Biotechnology» of the RK, Astana 
 
Keywords: agaricales fungi, collection of strains, macromycetes, mycelial culture, PCR diagnostics. 
Abstract. It was studied 94 species of Agaricales fungi on the area of 4 State National nature parks «Кokshe-
tau», «Каrkaly», «Burabay» and «Baian-aul». Fungi were grown on a solid agar medium, morphological and cultural 
characteristics and growth parameters of mycelium of 57 most actively growing strains from 17 species of edible 
agaricales saprotrophs and xylotrophs were studied. It was done molecular identification of Psathyrella candolleana 
(strain Psc9) and Pholiota adiposа (strain Pha4). Results were compared with the dates of corresponding species from 
the Gene Bank.  
On the territory of the four national parks located in the Central and North-East Kazakhstan there were revealed 
104 species agaricales fungi belonging to 10 families. Research on solid agar medium features radial mycelial 
growth and character formation of colonies in 57 strains of the most valuable in respect of 17 species of edible sapro- 
xylotrophs and showed the following results. All the strains we investigated were in the rate of slow- and middle 
growing mycelial colonies. The vast majority of strains (48 strains) had high growth rate at 7-10 days of cultivation, 
and the remaining strains (9 strains) had the highest growth rate at 17-18 days from the beginning of cultivation. The 
most dense mycelium becomes over 4-4.5 weeks after the start of cultivation. Pigmentation of colonies is observed 
on the 33-42 day, mycelial film is formed 39-62 days of cultivation. 
 
 
УДК 581.5.(235.216)  
 
СЪЕДОБНЫЕ ГРИБЫ ПОРЯДКА AGARICALES ОСОБО 
ОХРАНЯЕМЫХ ПРИРОДНЫХ ТЕРРИТОРИЙ ЦЕНТРАЛЬНОГО  
И СЕВЕРО-ВОСТОЧНОГО КАЗАХСТАНА: СОЗДАНИЕ КОЛЛЕКЦИИ 
ШТАММОВ И ИХ МОЛЕКУЛЯРНАЯ ИДЕНТИФИКАЦИЯ  
 
С. А. Абиев
1
, А. В. Шнырева 
2
, Г. А. Нам
3
, Р. З. Асилханова
1
, Г. Абишева

 
1
Евразийский национальный университет им. Л. Н. Гумилева, Астана, Казахстан, 
2
Московский государственный университет им. М. В. Ломоносова, Москва, Россия, 
3
РГП «Институт Ботаники и Фитоинтордукции» МОН РК, Алматы, Казахстан, 
4
РГП «Национальный Центр Биотехнологии» РК, Астана, Казахстан 
 
Ключевые  слова:  агарикоидные  грибы,  коллекция  штаммов,  макромицеты,  мицелиальная  культура, 
ПЦР диагностика.  
Аннотация. Всего идентифицировано 94 вида агариковых грибов на территории 4-х Государственных 
национальных  природных  парков  «Кокшетау», «Каркаралы», «Бурабай»  и  «Баянауыл».  Были  выделены  на 
твердые  агаризованные  среды  и  изучены  морфолого-культуральные  признаки  и  ростовые  параметры 
мицелия у 57 штаммов из 17 видов агарикоидных съедобных сапротрофов и ксилотрофов. Была проведена 
молекулярная идентификация Psathyrella candolleana (штамм Psc9) и Pholiota adiposа (Pha4) и сопоставление 
результатов с данными соответствующих видов, депонированных в Gene Bank.  

ISSN 2224-5308
 
                                                                               Серия биологическая и медицинская. № 3. 2015 
 
 
155 
Грибы - ценный пищевой продукт. В настоящее время грибы являются обычным товаром на 
прилавках  продуктовых  магазинов  во  многих  странах  мира.  Если  раньше  предлагалось  потре-
бителю,  в  основном  дикорастущие  (лесные)  грибы,  которые  поставляли  различные  любители 
"тихой  охоты",  то  сегодня  в  торговой  сети  преобладают  импортные  грибы,  выращенные  в 
искусственных  условиях.  О  стремительном  росте  производства  культувируемых  грибов  говорит 
тот  факт,  что  уже  в 90-е  годы  в  общем  объеме  ежегодного  потребления  грибов  в  мире  доля 
"лесных" составляла только около 20%, а в настоящее время этот показатель неуклонно снижается. 
В  ряде  стран  мира  грибная  индустрия  приносит  большие  доходы  его  производителям  и  вносит 
существенный вклад в обеспечение продовольственной безопасности этих стран [1]. 
В  Казахстане,  несмотря  на  его  огромные  сырьевые  возможности,  все  еще  не  налажено 
культивирование  грибов  в  промышленных  масштабах.  Единичные  в  республике  кустарные 
производства, предпринимаемые отдельными любителями, работают на завозимом из других стран 
штаммах.  Не  создана  коллекция  отечественных  высокоурожайных  штаммов  съедобных  грибов, 
которая необходима для начала организации в стране промышленного грибоводства. 
Традиционно  систематика  шляпочных  грибов  основывалась  на  их  морфологических  и 
трофических  характеристиках.  Однако,  такие  признаки,  как  размер  и  окраска  плодовых  тел  в 
пределах даже одного вида могут сильно варьировать в зависимости от экологических условий, что 
нередко приводит к ошибкам при определении их видовой принадлежности. В последнее время в 
связи  с  развитием  молекулярной  биологии  и  биоинформатики  популярным  подходом  для  иден-
тификации грибов становится использование филогенетических маркеров ITS последовательности 
(межгенной  транскрибируемой  спейсерной  последовательности)  кластера  генов  рибосомальных 
РНК изучаемого объекта. 
Гены,  кодирующие  структурные  гены  рРНК  являются  консервативными  последователь-
ностями,  в  то  время  как  внутренние  транскрибируемые  спейсерные  участки (ITS1/2) эволю-
ционируют быстрее и тем самым - демонстрируют высокий уровень вариабельности [2–4]. Данный 
факт  позволяет  использовать  спейсерные  участки  для  изучения  родственных  взаимоотношений 
между  филогенетически  близкими  видами,  в  том  числе  и  агарикоидных  грибов,  а  также  для 
молекулярной  идентификации  грибов,  видовая  идентификация  которых  по  морфологическим 
признакам затруднена [5].  
Целью  настоящей  работы  было  исследование  видового  состава  съедобных  агарикоидных 
грибов  Центрального  и  Северо-Восточного  Казахстана,  выделение  из  наиболее  ценных  видов 
мицелиальных  культур  и  изучение  культурально-морфологических  особенностей  выделенных  в 
чистую  культуру  штаммов  на  различных  твердых  питательных  средах.  В  задачу  данной  работы 
входило также проведение молекулярной идентификации некоторых видов с целью  верификации 
(подтверждения) их видовой принадлежности. 
 
Материалы и методы исследования 
 
Сбор плодовых тел грибов осуществляли во время маршрутных обследований территорий по 
общепринятой  методике.  Идентификации  грибов  проводили  на  основе  макро-  и  микроморфо-
метрических характеристик с использованием соответствующих определителей [6–8].  
Выделение  мицелиальных  культур  высших  базидиомицетов.  Выделение  мицелиальных  куль-
тур  проводили  на  твердых  питательных  средах  (сусло-агар,  картофельно-глюкозный  агар,  агар 
Чапека-Докса  и  Сабуро)  тканевым  методом  непосредственно  из  плодовых  тел.  Плодовые  тела 
грибов собирали в период их массового появления. Выделение мицелиальных культур проводили в 
день сбора образцов или же из плодовых тел, хранившихся в холодильнике не более 3 суток. Для 
выделения  выбирали  молодые,  крепкие,  неинфицированные  карпофоры.  Перед  выделением  пло-
довое тело очищали от посторонних примесей и промывали в проточной и стерильной воде, просу-
шивали  фильтровальной  бумагой.  Затем  плодовое  тело  обрабатывали 96°- этиловым  спиртом. 
Кусочки  трамы,  вырезанные  кубиком (0,5-0,8 см
3
)  из  разных  частей  плодового  тела  (шляпки, 
ножки,  мест  перехода  шляпки  в  ножку)  стерильным  пинцетом  переносили  на  твердую  питатель-
ную среду. В питательную среду добавляли ампициллин (100-200 ед/мл) или фундазол (50 мкг/мл) 
для  подавления  роста  посторенней  микрофлоры.  Чашки  Петри  с  инокулюмом  инкубировали  в 

Известия Национальной академии наук Республики Казахстан  
 
 
   
156  
термостате  при  температуре 26,5°С.  Для  очистки  культур  от  случайных  посторонних  инфекций, 
кроме  антибиотиков,  использовали  метод  повторных  пересевов.  Все  операции  по  выделению 
тканевых культур проводили в ламинарном боксе. 
Выделение ДНК. Для выделения ДНК использовали буферный раствор, содержащий 100 mM 
Tris-HCl, pH 8,0, 1,4 M NaCl, 20 mM EDTA, 2% CTAB, протеиназу К 100 
g/ml [9,10,11]. Брали 10-
12  суточные  мицелиальные  культуры,  помещали  в  стерильную  ступку,  добавляли  жидкий  азот  и 
растирали  до  гомогенного  состояния. 100 мкл  полученной  суспензии  переносили  в  стерильную             
1,5 мл пробирку, добавляли 500 мкл соответствующего буфера. Инкубировали в течение 18 часов. 
Далее  проводили  очистку  ДНК  фенол/хлороформным  методом.  С  этой  целью  к  полученной 
суспензии  добавляли 750 мкл  хлороформ/изоамилового  спирта (24:1), тщательно  перемешали  и 
центрифугировали при 12000 об/мин в течение 10 минут. Водную фазу переносили в новую про-
бирку и повторяли очистку со смесью фенол/хлороформ (1:1). После центрифугирования водную 
фазу  переносили  в  новые  чистые  пробирки  и  осаждали  ДНК 600 мкл  изопропилового  спирта. 
Центрифугировали при 12000 об/мин в течение 10 минут, осадок ДНК промывали 70% этиловым 
спиртом  с  последующим  центрифугированием  и  удалением  жидкой  фазы.  Затем  осадок  подсу-
шивали на воздухе в течение 15 минут. Образцы ДНК растворяли в 100 мкл однократного ТЕ буфе-
ра и хранили при минус 20°С. Концентрацию ДНК измеряли с использованием спектрофотометра 
NanoDrop при длине волны 260 нм. 
Амплификация ITS последовательности.  ПЦР  проводили  с  праймерами ITS 5 5’ – 
ggaagtaaaagtcgtaacaagg-3’  и ITS 4 5’- tcctccgcttattgatatgc -3’ в  общем  объеме  реакционной  смеси                
30 мкл. ПЦР смесь содержала 40 нг ДНК, 1ед. Taq DNA Polymerase (Fermentas), 0,2 mM каждого 
дНТФ (дезоксинуклеозодтрифосфата), 1-кратный ПЦР буфер (Fermentas), 2,5 mM MgCl
2
, 10 пмоль 
каждого праймера. Программа ПЦР амплификации включала первичную денатурацию при 95°С в 
течение 4 минут с последующими 30 циклами: 95°С – 25 секунд, 52°С- 30 секунд, 72°С – 40 секунд; 
заключительная элонгация 7 минут при 72°С. ПЦР проводили в амплификаторе DNA Engine Tetrad 
2 Cycler PTC-0240 (Bio-Rad).  
Определение  нуклеотидной  последовательности.  Очистку  ПЦР  продуктов  от  несвязавшихся 
праймеров проводили ферментативным методом используя Exonuclease I (Fermentas) и щелочную 
фосфатазу (Shrimp Alkaline Phosphatase, Fermentas). 
Реакцию секвенирования проводили с применением BigDye® Terminator v3.1 Cycle Sequencing 
Kit (Applied Biosystems) согласно  инструкции  производителя,  с  последующим  разделением 
фрагментов  на  автоматическом  генетическом  анализаторе 3730xl DNA Analyzer (Applied 
Biosystems). 
Молекулярную  идентификацию  штаммов  грибов  проводили  методом  определения  прямой 
нуклеотидной  последовательности ITS региона  и  сопоставлением  ее  идентичности  с  нуклео-
тидными  последовательностями  видов,  депонированных  в  международной  базе  данных GenBank 
(www.ncbi.nlm.nih.gov).  
 
Результаты исследования 
 
Обследование  и  сбор  плодовых  тел  грибов  осуществляли  на  территории  четырех  государ-
ственных  национальных  природных  парков  «Кокшетау», «Бурабай» «Каркаралы»  и  «Баянауыл», 
расположенных в центральной и северо-восточной части Казахстана. Выбор территорий нацпарков 
связан  с  тем,  что  эти  территории  менее  подвержены  воздействию  человека  и  отличаются  более 
богатым, эволюционно сложившимся природным разнообразием грибов. 
Всего  было  собрано  и  идентифицировано 94 вида  агарикоидных  грибов  из 18 семейств  и         
37 родов, в том числе: Russulaceae - 23 видов, Tricholomataceae - 13 видов, Agaricaceae - 12 видов. 
Остальные  семейства (Boletaceae, Paxillaceae, Amanitaceae, Gomphidiaceae, Cortinariaceae, 
Strophariaceae) включали от 2 до 10 видов. Из сем. Hygrophoraceae, Gloeophyllaceae, Hydnangiaceae, 
Tapinellaceae  и Psathyrelleacea были  обнаружены  всего  по 1 виду.  Собранные  виды  состояли,  в 
основном,  из  подстилочных  и  гумусовых  сапротрофов.  Ряд  видов  относится  к  микоризо-
образователям. Съедобными являются 69, несъедобными – 12 видов, съедобность не установлено у 
9  видов. Ядовитые виды  немногочисленны - всего 4 вида: Agaricus xanthodermus, Suillis piperatus 
Amanita muscaria, Hypholoma sublateritium. 

ISSN 2224-5308
 
                                                                               Серия биологическая и медицинская. № 3. 2015 
 
 
157 
Характеристика роста мицелиальных колоний различных штаммов грибов на плотной агаризованной среде (сусло-агар) 
 
Штаммы 
Время культивирования, сутки 
Образование 
паутино- 
видного мицелия 
Уплотнение 
Мицелия 
 
Образование  
плотных мице-
лиальных бляшек
Образование 
пигментации  
на мицелии 
Образование 
мицелиальной
пленки 
1 2 




Sg 1 (Suillus granulates) 8 
23 
29 
33 
45 
Sg 23 (S. granulates) 10 
22 
27 
35 
43 
Sg 8 (S. granulates) 8 
16 
22 
34 
39 
Lc 1 (Lyophyllum connatum) 11 
20 
25 
43 
52 
Lc 15 (L. connatum) 11 
22 
24 
37 
50 
Lc 18 (L. connatum) 9 
16 
20 
33 
48 
Phs 3 (Pholiota squarrosa) 18 
25 
31 
39 
65 
Phs 10 (P. squarrosa) 16 
24 
33 
39 
62 
Phs15 (P. squarrosa) 17 
28 
35 
42 
61 
Km25 (Kuehneromyces mut abilis) 10 
23 
33  35  45 
Km 34 (K. mutabilis) 12 
23 
30 
34 
45 
Pp 4 (Pleurotus pulmonarius) 18 
28 
36 
42 
62 
Pp 6 (P. рulmonarius) 16 
27 
34 
41 
63 
Pp 8 (P. pulmonarius) 
19 
30 
37 
44 
64 
Pp 12 (P. pulmonarius) 
18 
29 
37 
45 
65 
Cg 3 (Clitocybe gibba) 

16 
25 
31 
39 
Cg 5 (C. gibba) 

17 
24 
33 
39 
Cg 7 (C. gibba) 

15 
23 
32 
40 
Cg 19 (C. gibba) 

17 
25 
31 
42 
Lecs 2 (Leccinum scabrum) 

15 
26 
29 
39 
Lecs 16 (L. scabrum) 

16 
23 
30 
41 
Lecs 18 (L. scabrum) 
10 
14 
21 
29 
43 
Lecs 24 (L. scabrum) 

16 
21 
28 
46 
Agt 6 (Agaricus tabularius) 

16 
22 
29 
43 
Agt 7 (A. tabularius) 

17 
23 
32 
47 
Agt 12 (A. tabularius) 
10 
18 
24 
29 
45 
Lacc 4 (Lactarius controversus) 

16 
25 
32 
49 
Lacc 15 (L. controversus) 
11 
19 
26 
31 
47 
Lacc 16 (L. controversus) 

16 
24 
32 
48 
Lacc 22 (L. controversus) 
10 
17 
26 
33 
51 
Pi 1 (Paxilus involutus) 

16 
22 
32 
47 
Pi 6 (P. involutus) 

16 
23 
32 
49 
Pi 9 (P. involutus) 
11 
18 
24 
30 
41 
Ld 5 (Lactarius deliciosus) 
10 
16 
25 
34 
53 
Ld 9 (L. deliciosus) 

17 
26 
32 
47 
Lp 2 (Lactarius pubescens) 

17 
24 
35 
52 
Lp 14 (L. pubescens) 
11 
19 
25 
35 
50 
Lp 23 (L. pubescens) 
10 
16 
24 
37 
49 
Be 8 (Boletus edulis) 

17 
26 
34 
47 
Be 12 (B. edulis) 
10 
18 
27 
33 
49 
Be 17 (B. edulis) 
10 
18 
25 
31 
53 
Be 20 (B. edulis) 
11 
17 
25 
32 
54 
Lv 7 (Lactarius vellereus) 
10 
16 
26 
31 
51 
Lv 13 (L. vellereus) 

15 
24 
32 
49 
Lv 16 (L. vellereus) 
11 
17 
26 
32 
51 
Psc 4 (Psathyrella candolleana) 

14 
23 
30 
39 
Psc 7 (P. candolleana) 

15 
24 
32 
39 
Psc 9 (P. candolleana) 

15 
23 
31 
38 
Psc 12 (P. candolleana) 

13 
24 
30 
39 

Известия Национальной академии наук Республики Казахстан  
 
 
   
158  
Продолжение таблицы 
1 2 




Agd 3 (Agrocybe dura) 

14 
25 
32 
40 
Agd 6 (A. dura) 

14 
24 
30 
37 
Agd 8 (A. dura) 

13 
25 
31 
39 
Agd 9 (A. dura) 

14 
26 
30 
37 
Agd 13 (A. dura) 

14 
24 
31 
36 
Agd 14 (A. dura) 

13 
24 
31 
37 
Pha 2 (Pholiota adiposa) 
13 
19 
27 
37 
47 
Pha 4 (P. adiposa) 
12 
19 
28 
37 
47 
 
Из 17 видов  агарикоидных  съедобных  сапро-  и  ксилотрофов  было  выделено 57 штаммов. 
Культурально-морфологические  признаки  исследуемых  штаммов  изучали  на  различных 
агаризованных питательных средах (сусло-агар, картофельно-глюкозный агар, агар Чапека-Докса и 
Сабуро).  Более  подходящим  для  мицелиального  роста  был  сусло-агар.  Учет  особенностей  роста 
колоний  проводили  в  течение  всего  срока  наблюдения  по  следующим  показателям:  текстура  и 
форма  колоний,  пигментация  мицелия,  плотность  и  высота  воздушного мицелия,  среднесуточная 
скорость роста, ростовой коэффициент.  
Особенности  радиального  роста  и  сроки  наступления  последующих  фаз  изменений  ми-
целиальных колоний штаммов показаны на рисунке. 
Согласно  классификации  А.  С.  Бухало [12], мицелиальные  колонии  базидиальных  грибов  по 
скорости роста можно разделить на три группы: I – быстрорастущие (РК > 100), II – растущие со 
средней  скоростью  (РК = 50-100) и III – медленнорастущие  (РК < 50). Все  исследованные  нами 
штаммы  относились  к  группе  медленно-  и  среднерастущих  мицелиальных  колоний.  На  плотной 
агаризованной  среде  (сусло-агар)  на  начальном  этапе  роста  мицелии  паутинистые,  затем 
мучнистые,  позже  войлочные,  стелящиеся  по  субстрату.  Полное  зарастание  питательной  среды  в 
чашках Петри (d = 95 мм) у большинства штаммов происходило через месяц.  
У  подавляющего  большинства  штаммов (48 штаммов): Sg-1, Sg-8, Sg-23, Lc-1, Lc-15, Lc-18, 
Km-25, Km-34, Cg-3, Cg-5, Cg-7, Cg-19, Ls-2, Ls-16, Ls-18, Ls-24, Agt-6, Agt-7, Agt-12, Lacc-4, Lacc-
15, Lacc-16, Lacc-22, Pi-1, Pi-6, Pi-9, Ld-5, Ld-9, Lp-2, Lp-14, Lp-23, Be-8, Be-12, Be-17, Be-20, Lv-7, 
Lv-13, Lv-16, Psc-4, Psc-7, Psc-9, Psc-12, Agd-3, Agd-6, Agd-8, Agd-9, Agd-13, Agd-14 - наибольший 
радиальный  скорость  роста  колоний  наблюдалась  на 7-10 сутки  культивирования.  У  остальных 
штаммов (9 штаммов): Phs-3, Phs-10, Phs-15, Pp-4, Pp-6, Pp-8, Pp-12, Pha-2, Pha-4 - наибольшие 
ростовые показатели были отмечены на 17-18-е сутки с начала культивирования.  
Начало  уплотнения  мицелия  отмечалось  на 12-17-е  сутки  культивирования,  но  наиболее 
плотный  ватно-войлочный  мицелий  с  бляшками  формировался  спустя  месяц  с  момента 
инокуляции  среды  в  чашках  Петри.  Образование  пигментации  на  мицелии  наблюдалось  на             
28 (Lecs18 (L. scabrum) – 45(Pp12 (P. pulmonarius) сутки, образование  мицелиальной  пленки – на   
38 (Psc 9 (P. candolleana)) - 64 (Pp 8 (P. pulmonarius)) сутки. 
Анализ  нуклеотидных  последовательностей.  Для  верификации  идентификации  двух  видов 
агариковых грибов (Psathyrella сandolleana и Pholiota adiposа) брали два соответствующих штам-
ма - Psc9  и  Pha4.  Для  построения  филогенетического  дерева  родства  видов  на  основе  отсеквени-
рованных ITS последовательностей  рДНК  данных  штаммов  использовали  метод  максимального 
правдоподобия (ML) из  пакета  компьютерных  программ Mega 5 [13]. Обсчет  проводили  по                
705 сайтам отсеквенированных ITS последовательностей.  
Нуклеотидные  последовательности  были  проанализированы  и  объединены  в  общую  по-
следовательность  в  программе SeqMan (DNAStar). Затем  были  удалены  концевые  фрагменты 
(нуклеотидные  последовательности  праймеров  и  фрагменты,  имеющие  низкий  показатель 
качества). Полученные последовательности были идентифицированы с использованием баз данных 
GenBank по алгоритму BLAST.  
Молекулярная  идентификация  нуклеотидных  последовательностей  изученных  нами 2-х 
штаммов (Psc9, Pha4), принадлежащих двум видам агарикоидных грибов (Psathyrella candolleana и 
Pholiota adiposа),  и  сравнительный  анализ  с  гомологичными ITS последовательностями  из 
GenBank (HQ436117.1 Psathyrella candolleana; HQ436122.1 Pholiota adiposа) показали их 99%-ное  

ISSN 2224-5308
 
                                                                               Серия биологическая и медицинская. № 3. 2015 
 
 
159 
 
 
Филогенетическое дерево сходства на основе ITS последовательностей  
между штаммами Psc9 Psathyrella candolleana, Pha4 Pholiota adiposа и последовательностями из ГенБанка.  
Дерево построено с использованием алгоритма ML (Maximum Likelihood) в программе MEGA5 
 
 Pha4 Pholiota adiposa
 JF340271.1 Pholiota aurivella
 FJ596881.1 Pholiota aurivella
 AY251305.1 Pholiota aurivella
 JF908584.1 Pholiota aurivella
 JF908584.1 Pholiota cerifera
 JQ283958.1 Pholiota adiposa
 JQ283960.1 Pholiota adiposa
 FJ810180.1 Pholiota adiposa
 AB984617.1 Pholiota cf. aurivella
 JQ283956.1 Pholiota adiposa
 JF792631.1 Pholiota aurivella
 JQ283957.1 Pholiota adiposa
 AB984623.1 Pholiota cf. aurivella
 AB984625.1 Pholiota cf. squarrosa
 AB985280.1 Pholiota spumosa
 AB985279.1 Pholiota spumosa
 AB985282.1 Pholiota lubrica
 AB985284.1 Pholiota lubrica
 DQ389698.1 Psathyrella dicrani
 DQ389687.1 Psathyrella squamosa
 DQ389708.1 Psathyrella sphaerocystis
 DQ389717.1 Psathyrella coprophila
 KF414680.1 Psathyrella candolleana
 DQ093736.1 Psathyrella candolleana
 FJ168609.1 Psathyrella hymenocephala
 DQ494689.1 Psathyrella candolleana
 Psc9 Psathyrella candolleana
 FJ168608.1 Psathyrella hymenocephala
 GU062309.1 Psathyrella candolleana
 DQ093650.1 Psathyrella candolleana
 DQ389720.1 Psathyrella candolleana
 AB306311.1 Psathyrella candolleana
 KF281384.1 Psathyrella candolleana
 EU520251.1 Psathyrella candolleana
 NR119956.1 Agaricus murinocephalus
 NR119948.1 Agaricus erythrosarx
0.05

Известия Национальной академии наук Республики Казахстан  
 
 
   
160  
сходство  для  обоих  изученных  штаммов.  Для  более  надежного  подтверждения  видовой  принад-
лежности  штаммов Psc9 и Pha4 был  проведен  филогенетический  анализ  родства  на  основе ITS 
последовательностей  между  этими  штаммами  и  выборками ITS последовательностей  штаммов, 
депонированных  в  ГенБанке  (рисунок).  На  дендрограмме  штамм Psc9 попал  в  группу,  объеди-
нившую  все  штаммы  P. candolleana, последовательности  которых  были  взяты  из  ГенБанка. 
Поэтому  мы  считаем,  что  штамм Psc9 принадлежит  виду  Psathyrella candolleana.  Штамм Pha4 
попал в кладу, объединившую два близкородственных вида Ph. adiposa и Ph. aurivella, причем этот 
штамм Pha4 попал в подкладу со штаммами Ph. aurivella из Ген Банка. Согласно Index Fungorum, 
названия  видов  Ph. adiposa  и Ph. aurivella являются  синонимами,  поэтому  штамм Pha4 из  нашей 
коллекции  мы  относим  к  виду  Pholiota adiposа,  как  это  было  определено  на  основе  макромор-
фологических  характеристик  с  использованием  «Флора  споровых  растений  Казахстана,  Том 13. 

Каталог: journals -> 847
journals -> Н. Ю. Зуева (жауапты хатшы), О. Б. Алтынбекова, Г. Б. Мәдиева
journals -> Л-фараби атында ы аза лтты
journals -> Issn 1563-0269 Индекс 75871; 25871
journals -> Issn 2306-7365 1996 жылдың қарашасынан бастап екі айда бір рет шығады
journals -> ҚОҒамдық Ғылымдар мәселесі вопросы общественных наук
journals -> Казахский национальный
journals -> Ғылыми журнал 1996 жылдың қарашасынан бастап екі айда бір рет шығады
journals -> Казахский национальный
journals -> №4(68)/2012 Серия филология
847 -> Х а б а р л а р ы известия

жүктеу 5.08 Kb.

Поделитесь с Вашими друзьями:
1   ...   19   20   21   22   23   24   25   26   27




©emirb.org 2020
әкімшілігінің қараңыз

    Басты бет